Orthologous regulated operons containing pRL100211 gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Rhizobium etli CFN 42
Position: -209 Score: 5.16368 Sequence: AGTTTGATCTGCCTCAAAGA Position: -69 Score: 5.32776 Sequence: TTCTTGATCTGCATCAAGGA Locus tag: RHE_PD00292 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: RHE_PD00291 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: RHE_PD00290 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: RHE_PD00289 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: RHE_PD00288 Name: null Funciton: transcriptional regulator, Crp/Fnr family
ccoG-ccoH-ccoI-ccoS-RHE_PD00288	-209	5.2	AGTTTGATCTGCCTCAAAGA	RHE_PD00292
	-69	5.3	TTCTTGATCTGCATCAAGGA
Rhizobium leguminosarum bv. viciae 3841
Position: -241 Score: 4.75942 Sequence: AGTTTGACCGGTGTCAAGGA Position: -69 Score: 5.32776 Sequence: TTCTTGATCTGCATCAAGGA Locus tag: pRL90015 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: pRL90014 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: pRL90013 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: pRL90012A Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: pRL90012 Name: null Funciton: transcriptional regulator, Crp/Fnr family
ccoG-ccoH-ccoI-ccoS-pRL90012	-241	4.8	AGTTTGACCGGTGTCAAGGA	pRL90015
	-69	5.3	TTCTTGATCTGCATCAAGGA