Orthologous regulated operons containing COG5473 gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mesorhizobium sp. BNC1 | ||||
|
Position: -90
Score: 5.14974 Sequence: GATTTGATCCAGAGCAAAGT
Locus tag: Meso_2250
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Meso_2251
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Meso_2252
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Meso_2253
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Meso_2254
Name: COG5473 Funciton: Predicted integral membrane protein
Locus tag: Meso_2255
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Meso_2256
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-COG5473-ccoI-ccoS | -90 | 5.1 | GATTTGATCCAGAGCAAAGT | Meso_2250 |