Orthologous regulated operons containing ccoO gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | ||||
|
Position: -131
Score: 5.53442 Sequence: TTCTTGATCTGGATCAAGGT
Locus tag: Atu1537
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Atu1536
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Atu1535
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Atu1534
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
||||
| ccoN-ccoO-ccoQ-ccoP | -131 | 5.5 | TTCTTGATCTGGATCAAGGT | Atu1537 |
| Azorhizobium caulinodans ORS 571 | ||||
|
Position: -93
Score: 4.99923 Sequence: CCTTTGACTTGTATCAAGGT
Locus tag: AZC_4523
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: AZC_4524
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: AZC_4525
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: AZC_4526
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: AZC_4527
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: AZC_4528
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: AZC_4529
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: AZC_4530
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Locus tag: AZC_4531
Name: PF00083 Funciton: Predicted transporter, MFS family |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS-PF00083 | -93 | 5 | CCTTTGACTTGTATCAAGGT | AZC_4523 |
| Bradyrhizobium japonicum USDA 110 | ||||
|
Position: -73
Score: 4.78798 Sequence: ATCTTGATTTCAATCAATTC
Locus tag: blr2763
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: blr2764
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: bsr2765
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: blr2766
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
||||
| ccoN-ccoO-ccoQ-ccoP | -73 | 4.8 | ATCTTGATTTCAATCAATTC | blr2763 |
| Bradyrhizobium sp. BTAi1 | ||||
|
Position: -100
Score: 5.15966 Sequence: AACTTGATTTCGATCAATTC
Locus tag: BBta_2792
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: BBta_2793
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: BBta_2794
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
||||
| ccoN-ccoO-ccoP | -100 | 5.2 | AACTTGATTTCGATCAATTC | BBta_2792 |
| Brucella melitensis 16M | ||||
|
Position: -108
Score: 5.50733 Sequence: TGTTTGATTTAGATCAATGA
Locus tag: BMEI1564
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: BMEI1565
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: BMEI1566
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: BMEI1567
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: BMEI1568
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: BMEI1569
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) |
||||
| ccoN-ccoO-ccoP-ccoG-ccoH-ccoI | -108 | 5.5 | TGTTTGATTTAGATCAATGA | BMEI1564 |
| Mesorhizobium loti MAFF303099 | ||||
|
Position: -96
Score: 5.53145 Sequence: GCTTTGACCTGGATCAAGGC
Locus tag: mll6630
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: mll6629
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: msl6627
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: mll6628
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
||||
| ccoN-ccoO-ccoQ-ccoP | -96 | 5.5 | GCTTTGACCTGGATCAAGGC | mll6630 |
| Mesorhizobium sp. BNC1 | ||||
|
Position: -90
Score: 5.14974 Sequence: GATTTGATCCAGAGCAAAGT
Locus tag: Meso_2250
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Meso_2251
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Meso_2252
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Meso_2253
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Meso_2254
Name: COG5473 Funciton: Predicted integral membrane protein
Locus tag: Meso_2255
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Meso_2256
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-COG5473-ccoI-ccoS | -90 | 5.1 | GATTTGATCCAGAGCAAAGT | Meso_2250 |
| Rhizobium etli CFN 42 | ||||
|
Position: -105
Score: 5.21759 Sequence: TTGTTGATGTAGATCAAGGA
Locus tag: RHE_PD00296
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: RHE_PD00295
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: RHE_PD00294
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: RHE_PD00293
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
||||
| ccoN-ccoO-ccoQ-ccoP | -105 | 5.2 | TTGTTGATGTAGATCAAGGA | RHE_PD00296 |
| Rhizobium leguminosarum bv. viciae 3841 | ||||
|
Position: -96
Score: 5.21759 Sequence: TTGTTGATGTAGATCAAGGA
Locus tag: pRL90018
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: pRL90017
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: pRL90016A
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: pRL90016
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
||||
| ccoN-ccoO-ccoQ-ccoP | -96 | 5.2 | TTGTTGATGTAGATCAAGGA | pRL90018 |
| Rhizobium sp. NGR234 | ||||
|
Position: -115
Score: 5.53987 Sequence: ACCTTGATCTGAATCAAGGC
Locus tag: NGR_c17990
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: NGR_c17980
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: NGR_c17970
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
||||
| ccoN-ccoO-ccoP | -115 | 5.5 | ACCTTGATCTGAATCAAGGC | NGR_c17990 |
| Rhodopseudomonas palustris CGA009 | ||||
|
Position: -79
Score: 5.0962 Sequence: ATTTTGATTTCGATCAAACG
Locus tag: RPA0019
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: RPA0018
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: RPA0017
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: RPA0016
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: RPA0015
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: RPA0014
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: RPA0013
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: RPA0012
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS | -79 | 5.1 | ATTTTGATTTCGATCAAACG | RPA0019 |
| Sinorhizobium meliloti 1021 | ||||
|
Position: -109
Score: 5.72143 Sequence: CACTTGATCTGGATCAAGGT
Locus tag: SMa1220
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: SMa1216
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: SMa1214
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: SMa1213
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) |
||||
| ccoN-ccoO-ccoQ-ccoP | -109 | 5.7 | CACTTGATCTGGATCAAGGT | SMa1220 |
| Xanthobacter autotrophicus Py2 | ||||
|
Position: -97
Score: 5.16175 Sequence: GCTTTGACCTGTATCAAGGA
Locus tag: Xaut_0459
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Xaut_0460
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Xaut_0461
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Xaut_0462
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Xaut_0463
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Xaut_0464
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Xaut_0465
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Xaut_0466
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Locus tag: Xaut_0467
Name: PF00083 Funciton: Predicted transporter, MFS family |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS-PF00083 | -97 | 5.2 | GCTTTGACCTGTATCAAGGA | Xaut_0459 |