Orthologous regulated operons containing PF00083 gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Azorhizobium caulinodans ORS 571
Position: -93 Score: 4.99923 Sequence: CCTTTGACTTGTATCAAGGT Locus tag: AZC_4523 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: AZC_4524 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: AZC_4525 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: AZC_4526 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: AZC_4527 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: AZC_4528 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: AZC_4529 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: AZC_4530 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: AZC_4531 Name: PF00083 Funciton: Predicted transporter, MFS family
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS-PF00083	-93	5	CCTTTGACTTGTATCAAGGT	AZC_4523
Xanthobacter autotrophicus Py2
Position: -97 Score: 5.16175 Sequence: GCTTTGACCTGTATCAAGGA Locus tag: Xaut_0459 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Xaut_0460 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Xaut_0461 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Xaut_0462 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Xaut_0463 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Xaut_0464 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Xaut_0465 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Xaut_0466 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: Xaut_0467 Name: PF00083 Funciton: Predicted transporter, MFS family
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS-PF00083	-97	5.2	GCTTTGACCTGTATCAAGGA	Xaut_0459