Orthologous regulated operons containing PF00083 gene
| Regulog: | FnrN/FixK/AadR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | repressor (activator) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Azorhizobium caulinodans ORS 571 | ||||
|
Position: -93
Score: 4.99923 Sequence: CCTTTGACTTGTATCAAGGT
Locus tag: AZC_4523
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: AZC_4524
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: AZC_4525
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: AZC_4526
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: AZC_4527
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: AZC_4528
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: AZC_4529
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: AZC_4530
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Locus tag: AZC_4531
Name: PF00083 Funciton: Predicted transporter, MFS family |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS-PF00083 | -93 | 5 | CCTTTGACTTGTATCAAGGT | AZC_4523 |
| Xanthobacter autotrophicus Py2 | ||||
|
Position: -97
Score: 5.16175 Sequence: GCTTTGACCTGTATCAAGGA
Locus tag: Xaut_0459
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Xaut_0460
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Xaut_0461
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Xaut_0462
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Xaut_0463
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Xaut_0464
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Xaut_0465
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Xaut_0466
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Locus tag: Xaut_0467
Name: PF00083 Funciton: Predicted transporter, MFS family |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS-PF00083 | -97 | 5.2 | GCTTTGACCTGTATCAAGGA | Xaut_0459 |