Orthologous regulated operons containing ccoI gene

Properties
Regulog:	FnrN/FixK/AadR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/Alpha

Built upon 192 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -72 Score: 5.19607 Sequence: CACTTGATGTAAGTCAAGGA Locus tag: Atu1530 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Atu1529 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Atu1528 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Atu1527 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS	-72	5.2	CACTTGATGTAAGTCAAGGA	Atu1530
Azorhizobium caulinodans ORS 571
Position: -93 Score: 4.99923 Sequence: CCTTTGACTTGTATCAAGGT Locus tag: AZC_4523 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: AZC_4524 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: AZC_4525 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: AZC_4526 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: AZC_4527 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: AZC_4528 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: AZC_4529 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: AZC_4530 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: AZC_4531 Name: PF00083 Funciton: Predicted transporter, MFS family
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS-PF00083	-93	5	CCTTTGACTTGTATCAAGGT	AZC_4523
Bradyrhizobium japonicum USDA 110
Position: -74 Score: 5.25511 Sequence: CGTTTGAGCTGGATCAACGG Locus tag: blr2767 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: blr2768 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: blr2769 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: bsr2770 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS	-74	5.3	CGTTTGAGCTGGATCAACGG	blr2767
Bradyrhizobium sp. BTAi1
Position: -86 Score: 5.109 Sequence: CAATTGAGCTGGATCAACTG Locus tag: BBta_2795 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: BBta_2796 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: BBta_2797 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: BBta_2798 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS	-86	5.1	CAATTGAGCTGGATCAACTG	BBta_2795
Brucella melitensis 16M
Position: -108 Score: 5.50733 Sequence: TGTTTGATTTAGATCAATGA Locus tag: BMEI1564 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: BMEI1565 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: BMEI1566 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: BMEI1567 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: BMEI1568 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: BMEI1569 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoN-ccoO-ccoP-ccoG-ccoH-ccoI	-108	5.5	TGTTTGATTTAGATCAATGA	BMEI1564
Mesorhizobium loti MAFF303099
Position: -129 Score: 5.1199 Sequence: GGATTGACCTGCATCAACGC Locus tag: mll6626 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: mll6625 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: mll6624 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: msl6623 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS	-129	5.1	GGATTGACCTGCATCAACGC	mll6626
Mesorhizobium sp. BNC1
Position: -90 Score: 5.14974 Sequence: GATTTGATCCAGAGCAAAGT Locus tag: Meso_2250 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Meso_2251 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Meso_2252 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Meso_2253 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Meso_2254 Name: COG5473 Funciton: Predicted integral membrane protein Locus tag: Meso_2255 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Meso_2256 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-COG5473-ccoI-ccoS	-90	5.1	GATTTGATCCAGAGCAAAGT	Meso_2250
Rhizobium etli CFN 42
Position: -209 Score: 5.16368 Sequence: AGTTTGATCTGCCTCAAAGA Position: -69 Score: 5.32776 Sequence: TTCTTGATCTGCATCAAGGA Locus tag: RHE_PD00292 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: RHE_PD00291 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: RHE_PD00290 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: RHE_PD00289 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: RHE_PD00288 Name: null Funciton: transcriptional regulator, Crp/Fnr family
ccoG-ccoH-ccoI-ccoS-RHE_PD00288	-209	5.2	AGTTTGATCTGCCTCAAAGA	RHE_PD00292
	-69	5.3	TTCTTGATCTGCATCAAGGA
Rhizobium leguminosarum bv. viciae 3841
Position: -241 Score: 4.75942 Sequence: AGTTTGACCGGTGTCAAGGA Position: -69 Score: 5.32776 Sequence: TTCTTGATCTGCATCAAGGA Locus tag: pRL90015 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: pRL90014 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: pRL90013 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: pRL90012A Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: pRL90012 Name: null Funciton: transcriptional regulator, Crp/Fnr family
ccoG-ccoH-ccoI-ccoS-pRL90012	-241	4.8	AGTTTGACCGGTGTCAAGGA	pRL90015
	-69	5.3	TTCTTGATCTGCATCAAGGA
Rhizobium sp. NGR234
Position: -79 Score: 5.3209 Sequence: GACTTGACGCAGATCAAGGT Locus tag: NGR_c17930 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: NGR_c17920 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: NGR_c17910 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: NGR_c17900 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS	-79	5.3	GACTTGACGCAGATCAAGGT	NGR_c17930
Rhodopseudomonas palustris CGA009
Position: -79 Score: 5.0962 Sequence: ATTTTGATTTCGATCAAACG Locus tag: RPA0019 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: RPA0018 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: RPA0017 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: RPA0016 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: RPA0015 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: RPA0014 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: RPA0013 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: RPA0012 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS	-79	5.1	ATTTTGATTTCGATCAAACG	RPA0019
Sinorhizobium meliloti 1021
Position: -82 Score: 5.3209 Sequence: GACTTGACGCAGATCAAGGT Locus tag: SMa1211 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: SMa1210 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: SMa1209 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: SMa1208 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS	-82	5.3	GACTTGACGCAGATCAAGGT	SMa1211
Xanthobacter autotrophicus Py2
Position: -97 Score: 5.16175 Sequence: GCTTTGACCTGTATCAAGGA Locus tag: Xaut_0459 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Xaut_0460 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Xaut_0461 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Xaut_0462 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Xaut_0463 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Xaut_0464 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Xaut_0465 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Xaut_0466 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: Xaut_0467 Name: PF00083 Funciton: Predicted transporter, MFS family
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS-PF00083	-97	5.2	GCTTTGACCTGTATCAAGGA	Xaut_0459

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Orthologous regulated operons containing ccoI gene

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --