Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing ccoH gene

Properties
Regulog: FnrN/FixK/AadR - Rhizobiales
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: repressor (activator)
Biological process: Oxidative stress response; Nitrogen fixation
Effector: Oxygen
Phylum: Proteobacteria/Alpha
Built upon 192 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -72
Score: 5.19607
Sequence: CACTTGATGTAAGTCAAGGA
Locus tag: Atu1530
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Atu1529
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Atu1528
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Atu1527
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -72 5.2 CACTTGATGTAAGTCAAGGA Atu1530
Azorhizobium caulinodans ORS 571
Position: -93
Score: 4.99923
Sequence: CCTTTGACTTGTATCAAGGT
Locus tag: AZC_4523
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: AZC_4524
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: AZC_4525
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: AZC_4526
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: AZC_4527
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: AZC_4528
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: AZC_4529
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: AZC_4530
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Locus tag: AZC_4531
Name: PF00083
Funciton: Predicted transporter, MFS family
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS-PF00083 -93 5 CCTTTGACTTGTATCAAGGT AZC_4523
Bradyrhizobium japonicum USDA 110
Position: -74
Score: 5.25511
Sequence: CGTTTGAGCTGGATCAACGG
Locus tag: blr2767
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: blr2768
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: blr2769
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: bsr2770
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -74 5.3 CGTTTGAGCTGGATCAACGG blr2767
Bradyrhizobium sp. BTAi1
Position: -86
Score: 5.109
Sequence: CAATTGAGCTGGATCAACTG
Locus tag: BBta_2795
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: BBta_2796
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: BBta_2797
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: BBta_2798
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -86 5.1 CAATTGAGCTGGATCAACTG BBta_2795
Brucella melitensis 16M
Position: -108
Score: 5.50733
Sequence: TGTTTGATTTAGATCAATGA
Locus tag: BMEI1564
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: BMEI1565
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: BMEI1566
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: BMEI1567
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: BMEI1568
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: BMEI1569
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
ccoN-ccoO-ccoP-ccoG-ccoH-ccoI -108 5.5 TGTTTGATTTAGATCAATGA BMEI1564
Mesorhizobium loti MAFF303099
Position: -129
Score: 5.1199
Sequence: GGATTGACCTGCATCAACGC
Locus tag: mll6626
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: mll6625
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: mll6624
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: msl6623
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -129 5.1 GGATTGACCTGCATCAACGC mll6626
Rhizobium etli CFN 42
Position: -209
Score: 5.16368
Sequence: AGTTTGATCTGCCTCAAAGA
Position: -69
Score: 5.32776
Sequence: TTCTTGATCTGCATCAAGGA
Locus tag: RHE_PD00292
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: RHE_PD00291
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: RHE_PD00290
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: RHE_PD00289
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Locus tag: RHE_PD00288
Name: null
Funciton: transcriptional regulator, Crp/Fnr family
ccoG-ccoH-ccoI-ccoS-RHE_PD00288 -209 5.2 AGTTTGATCTGCCTCAAAGA RHE_PD00292
-69 5.3 TTCTTGATCTGCATCAAGGA
Rhizobium leguminosarum bv. viciae 3841
Position: -241
Score: 4.75942
Sequence: AGTTTGACCGGTGTCAAGGA
Position: -69
Score: 5.32776
Sequence: TTCTTGATCTGCATCAAGGA
Locus tag: pRL90015
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: pRL90014
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: pRL90013
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: pRL90012A
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Locus tag: pRL90012
Name: null
Funciton: transcriptional regulator, Crp/Fnr family
ccoG-ccoH-ccoI-ccoS-pRL90012 -241 4.8 AGTTTGACCGGTGTCAAGGA pRL90015
-69 5.3 TTCTTGATCTGCATCAAGGA
Rhizobium sp. NGR234
Position: -79
Score: 5.3209
Sequence: GACTTGACGCAGATCAAGGT
Locus tag: NGR_c17930
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: NGR_c17920
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: NGR_c17910
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: NGR_c17900
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -79 5.3 GACTTGACGCAGATCAAGGT NGR_c17930
Rhodopseudomonas palustris CGA009
Position: -79
Score: 5.0962
Sequence: ATTTTGATTTCGATCAAACG
Locus tag: RPA0019
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: RPA0018
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: RPA0017
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: RPA0016
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: RPA0015
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: RPA0014
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: RPA0013
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: RPA0012
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS -79 5.1 ATTTTGATTTCGATCAAACG RPA0019
Sinorhizobium meliloti 1021
Position: -82
Score: 5.3209
Sequence: GACTTGACGCAGATCAAGGT
Locus tag: SMa1211
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: SMa1210
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: SMa1209
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: SMa1208
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoG-ccoH-ccoI-ccoS -82 5.3 GACTTGACGCAGATCAAGGT SMa1211
Xanthobacter autotrophicus Py2
Position: -97
Score: 5.16175
Sequence: GCTTTGACCTGTATCAAGGA
Locus tag: Xaut_0459
Name: ccoN
Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Xaut_0460
Name: ccoO
Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Xaut_0461
Name: ccoQ
Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Xaut_0462
Name: ccoP
Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Xaut_0463
Name: ccoG
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Xaut_0464
Name: ccoH
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Xaut_0465
Name: ccoI
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Xaut_0466
Name: ccoS
Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
Locus tag: Xaut_0467
Name: PF00083
Funciton: Predicted transporter, MFS family
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS-PF00083 -97 5.2 GCTTTGACCTGTATCAAGGA Xaut_0459