Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing eutA gene

Properties
Regulog: EutR - Pseudomonadaceae
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Phylum: Proteobacteria/Gamma
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Pseudomonas aeruginosa PAO1
Position: -83
Score: 5.03645
Sequence: AATGTAGTGAAAAAAACATT
Locus tag: PA5506
Name: eutR
Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
Locus tag: PA5507
Name: COG1335
Funciton: Amidases related to nicotinamidase
Locus tag: PA5508
Name: eutB
Funciton: glutamine synthetase family protein
Locus tag: PA5509
Name: eutA
Funciton: putative N-formylglutamate amidohydrolase family protein
Locus tag: PA5510
Name: eutT
Funciton: Ethanolamine permease, APC family
eutR-COG1335-eutB-eutA-eutT -83 5 AATGTAGTGAAAAAAACATT PA5506
Pseudomonas fluorescens Pf-5
Position: -77
Score: 5.51523
Sequence: CATGTAGCGTCTATTACATA
Position: -38
Score: 4.39573
Sequence: TATGAAATAAAAACGACATC
Locus tag: PFL_2247
Name: eutR
Funciton: Transcriptional regulator of ethanolamine utilization, RpiR family
Locus tag: PFL_2246
Name: COG1335
Funciton: Amidases related to nicotinamidase
Locus tag: PFL_2245
Name: eutB
Funciton: glutamine synthetase family protein
Locus tag: PFL_2244
Name: eutA
Funciton: putative N-formylglutamate amidohydrolase family protein
Locus tag: PFL_2243
Name: eutT
Funciton: Ethanolamine permease, APC family
eutR-COG1335-eutB-eutA-eutT -77 5.5 CATGTAGCGTCTATTACATA PFL_2247
-38 4.4 TATGAAATAAAAACGACATC
© 2009-2020 RegPrecise