Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing eutX gene

Properties
Regulog: EutR - Oceanospirillales/Alteromonadales
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode:
Biological process: Ethanolamine utilization
Effector: Ethanolamine
Phylum: Proteobacteria/Gamma
Built upon 2 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chromohalobacter salexigens DSM 3043
Position: -64
Score: 4.82138
Sequence: TTTGAAAAAATATTGACACG
Locus tag: Csal_0675
Name: eutA
Funciton: N-formylglutamate amidohydrolase
Locus tag: Csal_0676
Name: eutQ
Funciton: TRAP-type ethanolamine transport system, small permease component
Locus tag: Csal_0677
Name: eutM
Funciton: TRAP-type ethanolamine transport system, large permease component
Locus tag: Csal_0678
Name: eutP
Funciton: TRAP-type ethanolamine transport system, periplasmic component
Locus tag: Csal_0679
Name: eutB
Funciton: glutamine synthetase family protein
Locus tag: Csal_0680
Name: eutX
Funciton: aldehyde dehydrogenase
Locus tag: Csal_0681
Name: eutY
Funciton: alcohol dehydrogenase
eutA-eutQ-eutM-eutP-eutB-eutX-eutY -64 4.8 TTTGAAAAAATATTGACACG Csal_0675
© 2009-2020 RegPrecise