Orthologous regulated operons containing eutX gene
| Regulog: | EutR - Oceanospirillales/Alteromonadales |
| Regulator type: | Transcription factor |
| Regulator family: | RpiR |
| Regulation mode: | |
| Biological process: | Ethanolamine utilization |
| Effector: | Ethanolamine |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | ||||
|
Position: -64
Score: 4.82138 Sequence: TTTGAAAAAATATTGACACG
Locus tag: Csal_0675
Name: eutA Funciton: N-formylglutamate amidohydrolase
Locus tag: Csal_0676
Name: eutQ Funciton: TRAP-type ethanolamine transport system, small permease component
Locus tag: Csal_0677
Name: eutM Funciton: TRAP-type ethanolamine transport system, large permease component
Locus tag: Csal_0678
Name: eutP Funciton: TRAP-type ethanolamine transport system, periplasmic component
Locus tag: Csal_0679
Name: eutB Funciton: glutamine synthetase family protein
Locus tag: Csal_0680
Name: eutX Funciton: aldehyde dehydrogenase
Locus tag: Csal_0681
Name: eutY Funciton: alcohol dehydrogenase |
||||
| eutA-eutQ-eutM-eutP-eutB-eutX-eutY | -64 | 4.8 | TTTGAAAAAATATTGACACG | Csal_0675 |