Orthologous regulated operons containing eutM gene

Properties
Regulog:	EutR - Oceanospirillales/Alteromonadales
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:
Biological process:	Ethanolamine utilization
Effector:	Ethanolamine
Phylum:	Proteobacteria/Gamma

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Chromohalobacter salexigens DSM 3043
Position: -64 Score: 4.82138 Sequence: TTTGAAAAAATATTGACACG Locus tag: Csal_0675 Name: eutA Funciton: N-formylglutamate amidohydrolase Locus tag: Csal_0676 Name: eutQ Funciton: TRAP-type ethanolamine transport system, small permease component Locus tag: Csal_0677 Name: eutM Funciton: TRAP-type ethanolamine transport system, large permease component Locus tag: Csal_0678 Name: eutP Funciton: TRAP-type ethanolamine transport system, periplasmic component Locus tag: Csal_0679 Name: eutB Funciton: glutamine synthetase family protein Locus tag: Csal_0680 Name: eutX Funciton: aldehyde dehydrogenase Locus tag: Csal_0681 Name: eutY Funciton: alcohol dehydrogenase
eutA-eutQ-eutM-eutP-eutB-eutX-eutY	-64	4.8	TTTGAAAAAATATTGACACG	Csal_0675

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --