Orthologous regulated operons containing grtT gene
| Regulog: | SdaR - Pseudomonadaceae |
| Regulator type: | Transcription factor |
| Regulator family: | SdaR |
| Regulation mode: | activator |
| Biological process: | Glycerate utilization |
| Effector: | D-glycerate |
| Phylum: | Proteobacteria/Gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Pseudomonas entomophila L48 | ||||
|
Position: -107
Score: 5.77049 Sequence: GGCTGTGCGAAAGCACAAAG
Locus tag: PSEEN2880
Name: grtT Funciton: Predicted D-glycerate transporter, MFS family |
||||
| grtT | -107 | 5.8 | GGCTGTGCGAAAGCACAAAG | PSEEN2880 |
| Pseudomonas fluorescens Pf-5 | ||||
|
Position: -2
Score: 5.29196 Sequence: CGTTGTTCAGTGGCACAGGG
Position: 30
Score: 5.58691 Sequence: CGCTGTGCGCCGGCACAAAG
Locus tag: PFL_3380
Name: grtT Funciton: Predicted D-glycerate transporter, MFS family |
||||
| grtT | -2 | 5.3 | CGTTGTTCAGTGGCACAGGG | PFL_3380 |
| 30 | 5.6 | CGCTGTGCGCCGGCACAAAG | ||
| Pseudomonas putida KT2440 | ||||
|
Position: -107
Score: 5.97178 Sequence: CGCTGTGCAAAAGCACAAAG
Locus tag: PP3176
Name: grtT Funciton: Predicted D-glycerate transporter, MFS family |
||||
| grtT | -107 | 6 | CGCTGTGCAAAAGCACAAAG | PP3176 |
| Pseudomonas syringae pv. tomato str. DC3000 | ||||
|
Position: -133
Score: 5.25065 Sequence: CGTTGTGCAATCACACAACA
Locus tag: PSPTO1906
Name: grtT Funciton: Predicted D-glycerate transporter, MFS family |
||||
| grtT | -133 | 5.3 | CGTTGTGCAATCACACAACA | PSPTO1906 |