Orthologous regulated operons containing grtT gene
| Regulog: | SdaR - Rhodospirillales |
| Regulator type: | Transcription factor |
| Regulator family: | SdaR |
| Regulation mode: | activator |
| Biological process: | Glycerate utilization |
| Effector: | D-glycerate |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Gluconacetobacter diazotrophicus PAl 5 | ||||
|
Position: -128
Score: 6.47826 Sequence: TTTAGTGCAGATGCACAAAG
Locus tag: Gdia_1381
Name: grtT Funciton: Predicted D-glycerate transporter, MFS family
Locus tag: Gdia_1380
Name: garK Funciton: Glycerate kinase (EC 2.7.1.31) |
||||
| grtT-garK | -128 | 6.5 | TTTAGTGCAGATGCACAAAG | Gdia_1381 |