Orthologous regulated operons containing uctT gene

Properties
Regulog:	AmtR - Mycobacteriaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Phylum:	Actinobacteria

Built upon 6 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Mycobacterium abscessus ATCC 19977
Position: -101 Score: 5.85042 Sequence: TTTACCTATCGCCTGACAGATATT Locus tag: MAB_4090 Name: uctT Funciton: Urea carboxylase-related transporter, Amino acid permease family Locus tag: MAB_4091 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: MAB_4092 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: MAB_4093 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6)
uctT-amt1-amt2-ucaA	-101	5.9	TTTACCTATCGCCTGACAGATATT	MAB_4090
Mycobacterium smegmatis str. MC2 155
Position: -60 Score: 6.59364 Sequence: GTTATCTGTCATCTGACAGGTAAG Locus tag: MSMEG_2184 Name: uctT Funciton: Urea carboxylase-related transporter, Amino acid permease family Locus tag: MSMEG_2185 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: MSMEG_2186 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: MSMEG_2187 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6) Locus tag: MSMEG_2189 Name: ucaB Funciton: Allophanate hydrolase (EC 3.5.1.54)
uctT-amt1-amt2-ucaA-ucaB	-60	6.6	GTTATCTGTCATCTGACAGGTAAG	MSMEG_2184

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --