Orthologous regulated operons containing ucaB gene

Properties
Regulog:	AmtR - Nocardiaceae
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Phylum:	Actinobacteria

Built upon 7 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Nocardia farcinica IFM 10152
Position: -51 Score: 6.36232 Sequence: CAAAACTATCAACCGACAGATATT Locus tag: nfa22220 Name: uctT Funciton: Urea carboxylase-related transporter, Amino acid permease family Locus tag: nfa22210 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: nfa22200 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: nfa22190 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6) Locus tag: nfa22180 Name: ucaB Funciton: Allophanate hydrolase (EC 3.5.1.54)
uctT-amt1-amt2-ucaA-ucaB	-51	6.4	CAAAACTATCAACCGACAGATATT	nfa22220

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --