Orthologous regulated operons containing arsR gene
| Regulog: | ArsR - Nocardiaceae |
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | repressor |
| Biological process: | Arsenic resistance |
| Effector: | Arsenite; Arsenate |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Nocardia farcinica IFM 10152 | ||||
|
Position: -13
Score: 6.46324 Sequence: TCAATATCGATGCATGTCTA
Locus tag: nfa24490
Name: arsR Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: nfa24500
Name: arsB Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: nfa24510
Name: arsC Funciton: Arsenate reductase (EC 1.20.4.1) |
||||
| arsR-arsB-arsC | -13 | 6.5 | TCAATATCGATGCATGTCTA | nfa24490 |
| Rhodococcus erythropolis PR4 | ||||
|
Position: -13
Score: 6.90937 Sequence: TCAATATCGAAGAATGTCGA
Locus tag: RER_35210
Name: arsR Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: RER_35200
Name: arsB Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: RER_35190
Name: arsC Funciton: Arsenate reductase (EC 1.20.4.1) |
||||
| arsR-arsB-arsC | -13 | 6.9 | TCAATATCGAAGAATGTCGA | RER_35210 |
| Rhodococcus opacus B4 | ||||
|
Position: -13
Score: 7.12383 Sequence: TCAATATCGACGCATGTCGA
Locus tag: ROP_29950
Name: arsR Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: ROP_29960
Name: arsB Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_29970
Name: arsC Funciton: Arsenate reductase (EC 1.20.4.1) |
||||
| arsR-arsB-arsC | -13 | 7.1 | TCAATATCGACGCATGTCGA | ROP_29950 |
| Rhodococcus sp. RHA1 | ||||
|
Position: -13
Score: 7.12383 Sequence: TCAATATCGACGCATGTCGA
Locus tag: RHA1_ro03367
Name: arsR Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: RHA1_ro03368
Name: arsB Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: RHA1_ro03369
Name: arsC Funciton: Arsenate reductase (EC 1.20.4.1) |
||||
| arsR-arsB-arsC | -13 | 7.1 | TCAATATCGACGCATGTCGA | RHA1_ro03367 |