Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing RSal33209_0614 gene

Properties
Regulog: Zur - Micrococcineae
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Actinobacteria
Built upon 40 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Renibacterium salmoninarum ATCC 33209
Position: -39
Score: 5.72178
Sequence: TAATGATCATGATGATCATTA
Locus tag: RSal33209_0614
Name: null
Funciton: NADH-FMN oxidoreductase
RSal33209_0614 -39 5.7 TAATGATCATGATGATCATTA RSal33209_0614
© 2009-2020 RegPrecise