Orthologous regulated operons containing znuB2 gene

Properties
Regulog:	Zur - Listeriaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Firmicutes

Built upon 24 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Listeria innocua Clip11262
Position: -89 Score: 6.2221 Sequence: TAATTCGAAGTAATTACGATTTA Locus tag: lin1485 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: lin1484 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: lin1483 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC2-znuB2-zur	-89	6.2	TAATTCGAAGTAATTACGATTTA	lin1485
Listeria monocytogenes EGD-e
Position: -89 Score: 6.2221 Sequence: TAATTCGAAGTAATTACGATTTA Locus tag: lmo1447 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: lmo1446 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: lmo1445 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC2-znuB2-zur	-89	6.2	TAATTCGAAGTAATTACGATTTA	lmo1447
Listeria seeligeri serovar 1/2b str. SLCC3954
Position: -88 Score: 6.2221 Sequence: TAATTCGAAGTTATTACGATTTA Locus tag: lse_1365 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: lse_1364 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: lse_1363 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC2-znuB2-zur	-88	6.2	TAATTCGAAGTTATTACGATTTA	lse_1365
Listeria welshimeri serovar 6b str. SLCC5334
Position: -89 Score: 6.2221 Sequence: TAATTCGAAGTAATTACGATTTA Locus tag: lwe1463 Name: znuC2 Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: lwe1462 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: lwe1461 Name: zur Funciton: Zinc homeostasis transcriptional regulator Zur, Fur family
znuC2-znuB2-zur	-89	6.2	TAATTCGAAGTAATTACGATTTA	lwe1463