Orthologous regulated operons containing mtsB gene
| Regulog: | MntR - Mycobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mycobacterium flavescens PYR-GCK | ||||
|
Position: -35
Score: 4.88737 Sequence: AGTTTCGGCGACCCGAAATC
Locus tag: Mflv_3168
Name: mtsA Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: Mflv_3167
Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Mflv_3166
Name: mtsC Funciton: Manganese ABC transporter, substrate-binding protein |
||||
| mtsA-mtsB-mtsC | -35 | 4.9 | AGTTTCGGCGACCCGAAATC | Mflv_3168 |
| Mycobacterium vanbaalenii PYR-1 | ||||
|
Position: -61
Score: 5.25207 Sequence: GTTTTCGGTCACCCAAACTT
Locus tag: Mvan_3371
Name: mtsA Funciton: Manganese ABC transporter, substrate-binding protein
Locus tag: Mvan_3370
Name: mtsB Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: Mvan_3369
Name: mtsC Funciton: Manganese ABC transporter, substrate-binding protein |
||||
| mtsA-mtsB-mtsC | -61 | 5.3 | GTTTTCGGTCACCCAAACTT | Mvan_3371 |