Orthologous regulated operons containing znuB2 gene
| Regulog: | Zur - Streptomycetaceae |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Streptomyces coelicolor A3(2) | ||||
|
Position: -34
Score: 4.8663 Sequence: TGTTGAACATGATTTTCATTG
Locus tag: SCO0475
Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: SCO0474
Name: SCO0474 Funciton: WD40/YVTN repeat-like-containing domain
Locus tag: SCO0473
Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: SCO0472
Name: SCO0472 Funciton: WD40/YVTN repeat-like-containing domain |
||||
| znuB2-SCO0474-znuA2-SCO0472 | -34 | 4.9 | TGTTGAACATGATTTTCATTG | SCO0475 |