Orthologous regulated operons containing cycA gene
| Regulog: | FnrN - Rhodospirillales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Magnetospirillum magneticum AMB-1 | ||||
|
Position: -78
Score: 5.88746 Sequence: GACTTGACCTTGCTCAATGC
Locus tag: amb0883
Name: cycA Funciton: Cytochrome c4 precursor |
||||
| cycA | -78 | 5.9 | GACTTGACCTTGCTCAATGC | amb0883 |
| Magnetospirillum magnetotacticum MS-1 | ||||
|
Position: -77
Score: 5.88746 Sequence: GACTTGACCTTGCTCAATGC
Locus tag: Magn03010752
Name: cycA Funciton: Cytochrome c4 precursor |
||||
| cycA | -77 | 5.9 | GACTTGACCTTGCTCAATGC | Magn03010752 |