Orthologous regulated operons containing ctaE gene

Properties
Regulog:	FixK - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/alpha

Built upon 25 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -45 Score: 5.62979 Sequence: GCCTTGATCGGGCTCAAATC Position: -12 Score: 4.89948 Sequence: GCCGTGAGGGATATGAAGGC Locus tag: CC3407 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: CC3406 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: CC3405 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: CC3404 Name: ctaX Funciton: Hypothetical protein in cta-cyo gene cluster Locus tag: CC3403 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: CC3402 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaD-ctaB-ctaX-ctaG-ctaE	-45	5.6	GCCTTGATCGGGCTCAAATC	CC3407
	-12	4.9	GCCGTGAGGGATATGAAGGC
Caulobacter segnis ATCC 21756
Position: -45 Score: 4.1852 Sequence: ACATTGATCATCGTCAAATC Position: -12 Score: 4.89948 Sequence: GCCGTGAGGGATATGAAGGC Locus tag: Cseg_0283 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: Cseg_0284 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: Cseg_0285 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: Cseg_0286 Name: ctaX Funciton: Hypothetical protein in cta-cyo gene cluster Locus tag: Cseg_0287 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: Cseg_0288 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaD-ctaB-ctaX-ctaG-ctaE	-45	4.2	ACATTGATCATCGTCAAATC	Cseg_0283
	-12	4.9	GCCGTGAGGGATATGAAGGC
Caulobacter sp. K31
Position: -75 Score: 4.3412 Sequence: ACGTTGATGTACGTCAAATC Position: -42 Score: 4.89948 Sequence: GCCGTGAGGGATATGAAGGC Locus tag: Caul_4506 Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1) Locus tag: Caul_4505 Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1) Locus tag: Caul_4504 Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB Locus tag: Caul_4503 Name: ctaX Funciton: Hypothetical protein in cta-cyo gene cluster Locus tag: Caul_4502 Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1 Locus tag: Caul_4501 Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1)
ctaC-ctaD-ctaB-ctaX-ctaG-ctaE	-75	4.3	ACGTTGATGTACGTCAAATC	Caul_4506
	-42	4.9	GCCGTGAGGGATATGAAGGC