Orthologous regulated operons containing ctaE gene
| Regulog: | FixK - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter crescentus CB15 | ||||
|
Position: -45
Score: 5.62979 Sequence: GCCTTGATCGGGCTCAAATC
Position: -12
Score: 4.89948 Sequence: GCCGTGAGGGATATGAAGGC
Locus tag: CC3407
Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: CC3406
Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Locus tag: CC3405
Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: CC3404
Name: ctaX Funciton: Hypothetical protein in cta-cyo gene cluster
Locus tag: CC3403
Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: CC3402
Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
||||
| ctaC-ctaD-ctaB-ctaX-ctaG-ctaE | -45 | 5.6 | GCCTTGATCGGGCTCAAATC | CC3407 |
| -12 | 4.9 | GCCGTGAGGGATATGAAGGC | ||
| Caulobacter segnis ATCC 21756 | ||||
|
Position: -45
Score: 4.1852 Sequence: ACATTGATCATCGTCAAATC
Position: -12
Score: 4.89948 Sequence: GCCGTGAGGGATATGAAGGC
Locus tag: Cseg_0283
Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: Cseg_0284
Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Locus tag: Cseg_0285
Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: Cseg_0286
Name: ctaX Funciton: Hypothetical protein in cta-cyo gene cluster
Locus tag: Cseg_0287
Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: Cseg_0288
Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
||||
| ctaC-ctaD-ctaB-ctaX-ctaG-ctaE | -45 | 4.2 | ACATTGATCATCGTCAAATC | Cseg_0283 |
| -12 | 4.9 | GCCGTGAGGGATATGAAGGC | ||
| Caulobacter sp. K31 | ||||
|
Position: -75
Score: 4.3412 Sequence: ACGTTGATGTACGTCAAATC
Position: -42
Score: 4.89948 Sequence: GCCGTGAGGGATATGAAGGC
Locus tag: Caul_4506
Name: ctaC Funciton: Cytochrome c oxidase polypeptide II (EC 1.9.3.1)
Locus tag: Caul_4505
Name: ctaD Funciton: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
Locus tag: Caul_4504
Name: ctaB Funciton: Heme O synthase, protoheme IX farnesyltransferase (EC 2.5.1.-) COX10-CtaB
Locus tag: Caul_4503
Name: ctaX Funciton: Hypothetical protein in cta-cyo gene cluster
Locus tag: Caul_4502
Name: ctaG Funciton: Cytochrome oxidase biogenesis protein Cox11-CtaG, copper delivery to Cox1
Locus tag: Caul_4501
Name: ctaE Funciton: Cytochrome c oxidase polypeptide III (EC 1.9.3.1) |
||||
| ctaC-ctaD-ctaB-ctaX-ctaG-ctaE | -75 | 4.3 | ACGTTGATGTACGTCAAATC | Caul_4506 |
| -42 | 4.9 | GCCGTGAGGGATATGAAGGC | ||