Orthologous regulated operons containing cydA gene

Properties
Regulog:	FixK - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/alpha

Built upon 25 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -93 Score: 6.17819 Sequence: GCCTTGATCCGGATCAAGGA Locus tag: CC0762 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: CC0763 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
cydA-cydB	-93	6.2	GCCTTGATCCGGATCAAGGA	CC0762
Caulobacter segnis ATCC 21756
Position: -92 Score: 5.75795 Sequence: TCCTTGATCACGATCAAGGC Locus tag: Cseg_3605 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: Cseg_3604 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) Locus tag: Cseg_3603 Name: cydX Funciton: CydX protein, presumably involved in maturation of CydAB complex
cydA-cydB-cydX	-92	5.8	TCCTTGATCACGATCAAGGC	Cseg_3605
Caulobacter sp. K31
Position: -92 Score: 5.4648 Sequence: TCCTTGACACCAATCAAAGC Locus tag: Caul_0634 Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-) Locus tag: Caul_0635 Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) Locus tag: Caul_0636 Name: cydX Funciton: CydX protein, presumably involved in maturation of CydAB complex
cydA-cydB-cydX	-92	5.5	TCCTTGACACCAATCAAAGC	Caul_0634

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --