Orthologous regulated operons containing cydA gene
| Regulog: | FixK - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter crescentus CB15 | ||||
|
Position: -93
Score: 6.17819 Sequence: GCCTTGATCCGGATCAAGGA
Locus tag: CC0762
Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Locus tag: CC0763
Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-) |
||||
| cydA-cydB | -93 | 6.2 | GCCTTGATCCGGATCAAGGA | CC0762 |
| Caulobacter segnis ATCC 21756 | ||||
|
Position: -92
Score: 5.75795 Sequence: TCCTTGATCACGATCAAGGC
Locus tag: Cseg_3605
Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Locus tag: Cseg_3604
Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Locus tag: Cseg_3603
Name: cydX Funciton: CydX protein, presumably involved in maturation of CydAB complex |
||||
| cydA-cydB-cydX | -92 | 5.8 | TCCTTGATCACGATCAAGGC | Cseg_3605 |
| Caulobacter sp. K31 | ||||
|
Position: -92
Score: 5.4648 Sequence: TCCTTGACACCAATCAAAGC
Locus tag: Caul_0634
Name: cydA Funciton: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
Locus tag: Caul_0635
Name: cydB Funciton: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
Locus tag: Caul_0636
Name: cydX Funciton: CydX protein, presumably involved in maturation of CydAB complex |
||||
| cydA-cydB-cydX | -92 | 5.5 | TCCTTGACACCAATCAAAGC | Caul_0634 |