Orthologous regulated operons containing cydC gene

Properties
Regulog:	FixK - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/alpha

Built upon 25 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Caulobacter crescentus CB15
Position: -50 Score: 6.17819 Sequence: TCCTTGATCCGGATCAAGGC Locus tag: CC0761 Name: cydD Funciton: ATP-binding/permease protein CydD Locus tag: CC0760 Name: cydC Funciton: ATP-binding/permease protein CydC
cydD-cydC	-50	6.2	TCCTTGATCCGGATCAAGGC	CC0761
Caulobacter segnis ATCC 21756
Position: -50 Score: 5.75795 Sequence: GCCTTGATCGTGATCAAGGA Locus tag: Cseg_3606 Name: cydD Funciton: ATP-binding/permease protein CydD Locus tag: Cseg_3607 Name: cydC Funciton: ATP-binding/permease protein CydC
cydD-cydC	-50	5.8	GCCTTGATCGTGATCAAGGA	Cseg_3606
Caulobacter sp. K31
Position: -77 Score: 4.06203 Sequence: CCCTATAGACGCGTCAAGGC Position: -51 Score: 5.4648 Sequence: GCTTTGATTGGTGTCAAGGA Locus tag: Caul_0633 Name: cydD Funciton: ATP-binding/permease protein CydD Locus tag: Caul_0632 Name: cydC Funciton: ATP-binding/permease protein CydC Locus tag: Caul_0631 Name: fixL Funciton: Two-component oxygen-sensor histidine kinase FixL Locus tag: Caul_0630 Name: fixJ Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixJ, LuxR family Locus tag: Caul_0629 Name: fixK Funciton: Nitrogen fixation and oxygen response transcriptional regulator FixK, Crp family
cydD-cydC-fixL-fixJ-fixK	-77	4.1	CCCTATAGACGCGTCAAGGC	Caul_0633
	-51	5.5	GCTTTGATTGGTGTCAAGGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --