Orthologous regulated operons containing ccoS gene
| Regulog: | FixK - Caulobacterales |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Oxidative stress response; Nitrogen fixation |
| Effector: | Oxygen |
| Phylum: | Proteobacteria/alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Caulobacter segnis ATCC 21756 | ||||
|
Position: -75
Score: 5.71291 Sequence: GCTTTGAGACAGATCAAAGC
Locus tag: Cseg_1883
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Cseg_1884
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Cseg_1885
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Cseg_1886
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Cseg_1887
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Cseg_1888
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Cseg_1889
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Cseg_1890
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS | -75 | 5.7 | GCTTTGAGACAGATCAAAGC | Cseg_1883 |
| Caulobacter sp. K31 | ||||
|
Position: -69
Score: 4.53934 Sequence: GCTTTGACCCAAGTCAATTT
Locus tag: Caul_2437
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: Caul_2438
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: Caul_2439
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: Caul_2440
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: Caul_2441
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: Caul_2442
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: Caul_2443
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Caul_2444
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS | -69 | 4.5 | GCTTTGACCCAAGTCAATTT | Caul_2437 |
| Phenylobacterium zucineum HLK1 | ||||
|
Position: -40
Score: 5.9562 Sequence: GCCTTGACCGATATCAAGGC
Locus tag: PHZ_c2814
Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
Locus tag: PHZ_c2813
Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
Locus tag: PHZ_c2812
Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
Locus tag: PHZ_c2811
Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
Locus tag: PHZ_c2810
Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
Locus tag: PHZ_c2809
Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH
Locus tag: PHZ_c2808
Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: PHZ_c2807
Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion |
||||
| ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS | -40 | 6 | GCCTTGACCGATATCAAGGC | PHZ_c2814 |