Orthologous regulated operons containing ccoP gene

Properties
Regulog:	FixK - Caulobacterales
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Phylum:	Proteobacteria/alpha

Built upon 25 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Caulobacter segnis ATCC 21756
Position: -75 Score: 5.71291 Sequence: GCTTTGAGACAGATCAAAGC Locus tag: Cseg_1883 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Cseg_1884 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Cseg_1885 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Cseg_1886 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Cseg_1887 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Cseg_1888 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Cseg_1889 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Cseg_1890 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS	-75	5.7	GCTTTGAGACAGATCAAAGC	Cseg_1883
Caulobacter sp. K31
Position: -69 Score: 4.53934 Sequence: GCTTTGACCCAAGTCAATTT Locus tag: Caul_2437 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Caul_2438 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Caul_2439 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Caul_2440 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Caul_2441 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Caul_2442 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Caul_2443 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Caul_2444 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS	-69	4.5	GCTTTGACCCAAGTCAATTT	Caul_2437
Phenylobacterium zucineum HLK1
Position: -40 Score: 5.9562 Sequence: GCCTTGACCGATATCAAGGC Locus tag: PHZ_c2814 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: PHZ_c2813 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: PHZ_c2812 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: PHZ_c2811 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: PHZ_c2810 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: PHZ_c2809 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: PHZ_c2808 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: PHZ_c2807 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
ccoN-ccoO-ccoQ-ccoP-ccoG-ccoH-ccoI-ccoS	-40	6	GCCTTGACCGATATCAAGGC	PHZ_c2814