Orthologous regulated operons containing PF05908 gene
| Regulog: | MntR - Mycobacteriaceae |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Actinobacteria |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Mycobacterium avium 104 | ||||
|
Position: -52
Score: 4.63707 Sequence: ATGTTCGACTACCCTCACTT
Locus tag: MAV_1044
Name: mntH Funciton: Manganese transport protein MntH
Locus tag: MAV_1043
Name: PF05908 Funciton: Protein of unknown function DUF867 |
||||
| mntH-PF05908 | -52 | 4.6 | ATGTTCGACTACCCTCACTT | MAV_1044 |
| Mycobacterium smegmatis str. MC2 155 | ||||
|
Position: -53
Score: 6.84888 Sequence: GATTTCGGCTAACCTAACTT
Locus tag: MSMEG_5589
Name: mntH Funciton: Manganese transport protein MntH
Locus tag: MSMEG_5591
Name: PF05908 Funciton: Protein of unknown function DUF867 |
||||
| mntH-PF05908 | -53 | 6.8 | GATTTCGGCTAACCTAACTT | MSMEG_5589 |
| Mycobacterium sp. JLS | ||||
|
Position: -51
Score: 6.66303 Sequence: GTTTTCGGCTAACCTAACTT
Locus tag: Mjls_4747
Name: mntH Funciton: Manganese transport protein MntH
Locus tag: Mjls_4748
Name: PF05908 Funciton: Protein of unknown function DUF867 |
||||
| mntH-PF05908 | -51 | 6.7 | GTTTTCGGCTAACCTAACTT | Mjls_4747 |