Orthologous regulated operons containing ttrR gene

Properties
Regulog:	TtrR - Shewanellaceae
Regulator type:	Transcription factor
Regulator family:	LuxR
Regulation mode:
Biological process:	Tetrathionate reduction
Effector:	Tetrathionate
Phylum:	Proteobacteria/gamma

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Shewanella baltica OS155
Position: -299 Score: 5.96429 Sequence: ACTATAGTGGTTTTCCACATATCA Locus tag: Sbal_0592 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: Sbal_0593 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
ttrS-ttrR	-299	6	ACTATAGTGGTTTTCCACATATCA	Sbal_0592
Shewanella putrefaciens CN-32
Position: -174 Score: 6.05628 Sequence: ACTATAGTGGTTTTCCACATATCG Locus tag: Sputcn32_0665 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: Sputcn32_0666 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
ttrS-ttrR	-174	6.1	ACTATAGTGGTTTTCCACATATCG	Sputcn32_0665
Shewanella sp ANA-3
Position: -147 Score: 5.88118 Sequence: ACTATAGTGGTTTTCCACATAGCG Locus tag: Shewana3_0636 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: Shewana3_0637 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
ttrS-ttrR	-147	5.9	ACTATAGTGGTTTTCCACATAGCG	Shewana3_0636
Shewanella sp MR-4
Position: -129 Score: 5.96429 Sequence: TCTATAGTGGTTTTCCACATATCG Locus tag: Shewmr4_0636 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: Shewmr4_0637 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
ttrS-ttrR	-129	6	TCTATAGTGGTTTTCCACATATCG	Shewmr4_0636
Shewanella sp W3-18-1
Position: -198 Score: 6.05628 Sequence: ACTATAGTGGTTTTCCACATATCG Locus tag: Sputw3181_3509 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: Sputw3181_3508 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
ttrS-ttrR	-198	6.1	ACTATAGTGGTTTTCCACATATCG	Sputw3181_3509