Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing sirC gene

Properties
Regulog: PhsR - Vibrionales
Regulator type: Transcription factor
Regulator family: LuxR
Regulation mode: activator
Biological process: Thiosulfate reduction
Effector: Thiosulfate
Phylum: Proteobacteria/gamma
Built upon 6 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Vibrio fischeri ES114
Position: -224
Score: 7.49854
Sequence: ATTATTGTGGTTTACCACAATAGT
Locus tag: VF_A0101
Name: sirA
Funciton: Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit
Locus tag: VF_A0100
Name: sirC
Funciton: Predicted sulfide reductase, anchor subunit
Locus tag: VF_A0099
Name: sirB
Funciton: Predicted sulfide reductase, FeS cluster subunit
Locus tag: VF_A0098
Name: yceA
Funciton: Predicted thiosulfate sulfurtransferase
sirA-sirC-sirB-yceA -224 7.5 ATTATTGTGGTTTACCACAATAGT VF_A0101
Vibrio parahaemolyticus RIMD 2210633
Position: -215
Score: 7.28224
Sequence: ATTATTGTGGGAAACCACAATACC
Locus tag: VP1200
Name: sirA
Funciton: Predicted sulfide reductase, catalytic and NADH- and FAD-binding subunit
Locus tag: VP1199
Name: sirC
Funciton: Predicted sulfide reductase, anchor subunit
Locus tag: VP1198
Name: sirB
Funciton: Predicted sulfide reductase, FeS cluster subunit
Locus tag: VP1197
Name: yceA
Funciton: Predicted thiosulfate sulfurtransferase
sirA-sirC-sirB-yceA -215 7.3 ATTATTGTGGGAAACCACAATACC VP1200
© 2009-2020 RegPrecise