Orthologous regulated operons containing nfa23280 gene

Properties
Regulog:	Zur - Nocardiaceae
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Actinobacteria

Built upon 31 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Nocardia farcinica IFM 10152
Position: -35 Score: 5.1838 Sequence: TAGTGATAATCGTTTTCATCT Locus tag: nfa23260 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: nfa23270 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: nfa23280 Name: nfa23280 Funciton: WD40/YVTN repeat-like-containing domain
znuB2-znuA2-nfa23280	-35	5.2	TAGTGATAATCGTTTTCATCT	nfa23260
Rhodococcus erythropolis PR4
Position: -39 Score: 4.99564 Sequence: CTTTGACAATCATTTACATTA Locus tag: RER_54290 Name: nfa23280 Funciton: WD40/YVTN repeat-like-containing domain
nfa23280	-39	5	CTTTGACAATCATTTACATTA	RER_54290
Rhodococcus opacus B4
Position: -47 Score: 4.58332 Sequence: CTTTGACAACCGTTTGCAAAA Position: -31 Score: 5.74596 Sequence: TTACGACAATCATTATCGTTA Locus tag: ROP_22700 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: ROP_22710 Name: ROP_22710 Funciton: WD40/YVTN repeat-like-containing domain Locus tag: ROP_22720 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: ROP_22730 Name: nfa23280 Funciton: WD40/YVTN repeat-like-containing domain
znuB2-ROP_22710-znuA2-nfa23280	-47	4.6	CTTTGACAACCGTTTGCAAAA	ROP_22700
	-31	5.7	TTACGACAATCATTATCGTTA
Rhodococcus sp. RHA1
Position: -47 Score: 4.7047 Sequence: CTTTGACAACCGTTTGCAATA Position: -31 Score: 5.74596 Sequence: TTACGACAATCATTATCGTTA Locus tag: RHA1_ro02546 Name: znuB2 Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB Locus tag: RHA1_ro02547 Name: ROP_22710 Funciton: WD40/YVTN repeat-like-containing domain Locus tag: RHA1_ro02548 Name: znuA2 Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: RHA1_ro02549 Name: nfa23280 Funciton: WD40/YVTN repeat-like-containing domain
znuB2-ROP_22710-znuA2-nfa23280	-47	4.7	CTTTGACAACCGTTTGCAATA	RHA1_ro02546
	-31	5.7	TTACGACAATCATTATCGTTA