Orthologous regulated operons containing ABC3215 gene
| Regulog: | XylR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | Xylose utilization |
| Effector: | Xylose |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bacillus clausii KSM-K16 | ||||
|
Position: -56
Score: 6.36924 Sequence: ACTTAGTTTATTTCATAAACAAACA
Locus tag: ABC3215
Name: null Funciton: Possible alpha-xyloside ABC transporter, substrate-binding component
Locus tag: ABC3214
Name: null Funciton: Possible alpha-xyloside ABC transporter, permease component
Locus tag: ABC3213
Name: null Funciton: Possible alpha-xyloside ABC transporter, permease component |
||||
| ABC3215-ABC3214-ABC3213 | -56 | 6.4 | ACTTAGTTTATTTCATAAACAAACA | ABC3215 |