Orthologous regulated operons containing PF02743 gene
| Regulog: | UxuR - Clostridia-3 |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Glucuronate utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Roseburia intestinalis L1-82 | ||||
|
Position: -45
Score: 6.08882 Sequence: AAATGTAACCGCTTACATAA
Locus tag: ROSINTL182_00594
Name: PF02743 Funciton: hypothetical protein |
||||
| PF02743 | -45 | 6.1 | AAATGTAACCGCTTACATAA | ROSINTL182_00594 |