Orthologous regulated operons containing uxuB gene
| Regulog: | UxuR - Clostridia-3 |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Glucuronate utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bryantella formatexigens DSM 14469 | ||||
|
Position: -228
Score: 6.31368 Sequence: AAATGTAAGCGCTTACACAA
Position: -78
Score: 5.94932 Sequence: GATTGTAAGCGCTTACATGG
Locus tag: BRYFOR_01978
Name: uxuB Funciton: D-mannonate oxidoreductase (EC 1.1.1.57) |
||||
| uxuB | -228 | 6.3 | AAATGTAAGCGCTTACACAA | BRYFOR_01978 |
| -78 | 5.9 | GATTGTAAGCGCTTACATGG | ||