Orthologous regulated operons containing ugl gene
| Regulog: | UxuR - Clostridia-3 |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Glucuronate utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Roseburia intestinalis L1-82 | ||||
|
Position: -126
Score: 6.33435 Sequence: ATTTGTAAGCGCTTACAAAA
Locus tag: ROSINTL182_00339
Name: ugl Funciton: Unsaturated glucuronyl hydrolase (EC 3.2.1.- |
||||
| ugl | -126 | 6.3 | ATTTGTAAGCGCTTACAAAA | ROSINTL182_00339 |