Orthologous regulated operons containing uxuQM2 gene

Properties
Regulog:	GulR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:
Biological process:	Glucarate utilization; Galactarate utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bradyrhizobium japonicum USDA 110
Position: -151 Score: 4.80007 Sequence: ATCAATCTGCGTTCGGCATTGAT Position: -130 Score: 5.73582 Sequence: ATCCATACCTGAATTGGATCGAT Locus tag: bll6551 Name: uxuP2 Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component Locus tag: bll6550 Name: uxuQM Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component / large permease component
uxuP2-uxuQM	-151	4.8	ATCAATCTGCGTTCGGCATTGAT	bll6551
	-130	5.7	ATCCATACCTGAATTGGATCGAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --