Orthologous regulated operons containing uxuQ gene
| Regulog: | GulR - Rhizobiales |
| Regulator type: | Transcription factor |
| Regulator family: | LysR |
| Regulation mode: | |
| Biological process: | Glucarate utilization; Galactarate utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Bradyrhizobium sp. BTAi1 | ||||
|
Position: -183
Score: 6.22088 Sequence: ATCGATGCAAGTCTTGCATTGAT
Locus tag: BBta_0128
Name: uxuP Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component
Locus tag: BBta_0129
Name: uxuQ Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component
Locus tag: BBta_0130
Name: uxuM Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component |
||||
| uxuP-uxuQ-uxuM | -183 | 6.2 | ATCGATGCAAGTCTTGCATTGAT | BBta_0128 |