Orthologous regulated operons containing uxuP gene

Properties
Regulog:	GulR - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LysR
Regulation mode:
Biological process:	Glucarate utilization; Galactarate utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 13 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bradyrhizobium sp. BTAi1
Position: -183 Score: 6.22088 Sequence: ATCGATGCAAGTCTTGCATTGAT Locus tag: BBta_0128 Name: uxuP Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, periplasmic component Locus tag: BBta_0129 Name: uxuQ Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, small permease component Locus tag: BBta_0130 Name: uxuM Funciton: Predicted glucuronate /galacturonate TRAP-type transporter, large permease component
uxuP-uxuQ-uxuM	-183	6.2	ATCGATGCAAGTCTTGCATTGAT	BBta_0128

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --