Orthologous regulated operons containing Mmol_0765 gene

Properties
Regulog:	SdhR - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Tricarboxylic acid cycle
Effector:
Phylum:	Proteobacteria/Beta

Built upon 24 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Methylotenera mobilis JLW8
Position: -115 Score: 7.36725 Sequence: TCTTATGTCTTATATAAGATATAAAA Locus tag: Mmol_0754 Name: sdhR Funciton: Transcriptional regulator of TCA cycle, GntR family Locus tag: Mmol_0755 Name: null Funciton: hypothetical protein Locus tag: Mmol_0756 Name: MB2181_04035 Funciton: Malate dehydrogenase (oxaloacetate-decarboxylating) (NADP(+)) Locus tag: Mmol_0757 Name: sdhC Funciton: Succinate dehydrogenase cytochrome b-556 subunit Locus tag: Mmol_0758 Name: sdhD Funciton: Succinate dehydrogenase, hydrophobic subunit, cytochrome b556 Locus tag: Mmol_0759 Name: sdhA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Mmol_0760 Name: sdhB Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) Locus tag: Mmol_0761 Name: COG2938 Funciton: succinate dehydrogenase iron-sulfur subunit Locus tag: Mmol_0762 Name: citE Funciton: Citrate lyase beta chain (EC 4.1.3.6) Locus tag: Mmol_0763 Name: MB2181_04000 Funciton: acetyl-coenzyme A synthetase family protein Locus tag: Mmol_0764 Name: fumA Funciton: Fumarate hydratase class I (EC 4.2.1.2) Locus tag: Mmol_0765 Name: null Funciton: hypothetical protein Locus tag: Mmol_0766 Name: acnB Funciton: Aconitate hydratase (EC 4.2.1.3)
sdhR-Mmol_0755-MB2181_04035-sdhC-sdhD-sdhA-sdhB-COG2938-citE-MB2181_04000-fumA-Mmol_0765-acnB	-115	7.4	TCTTATGTCTTATATAAGATATAAAA	Mmol_0754

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --