Orthologous regulated operons containing sdhA gene

Properties
Regulog:	SdhR - Alcaligenaceae
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Tricarboxylic acid cycle
Effector:
Phylum:	Proteobacteria/Beta

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Bordetella avium 197N
Position: -184 Score: 7.81343 Sequence: TCTTATATCTTATATAAGACATAAGA Locus tag: BAV1181 Name: sdhR Funciton: Transcriptional regulator of TCA cycle, GntR family Locus tag: BAV1182 Name: sdhC Funciton: Succinate dehydrogenase cytochrome b-556 subunit Locus tag: BAV1183 Name: sdhD Funciton: Succinate dehydrogenase, hydrophobic subunit, cytochrome b556 Locus tag: BAV1184 Name: sdhA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: BAV1185 Name: sdhB Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) Locus tag: BAV1186 Name: COG2938 Funciton: succinate dehydrogenase iron-sulfur subunit Locus tag: BAV1187 Name: gltA Funciton: Citrate synthase (si) (EC 2.3.3.1)
sdhR-sdhC-sdhD-sdhA-sdhB-COG2938-gltA	-184	7.8	TCTTATATCTTATATAAGACATAAGA	BAV1181
Bordetella bronchiseptica RB50
Position: -140 Score: 7.81343 Sequence: TCTTATATCTTATATAAGACATAAGA Locus tag: BB3683 Name: sdhR Funciton: Transcriptional regulator of TCA cycle, GntR family Locus tag: BB3682 Name: sdhC Funciton: Succinate dehydrogenase cytochrome b-556 subunit Locus tag: BB3681 Name: sdhD Funciton: Succinate dehydrogenase, hydrophobic subunit, cytochrome b556 Locus tag: BB3680 Name: sdhA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: BB3679 Name: sdhB Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) Locus tag: BB3678 Name: COG2938 Funciton: succinate dehydrogenase iron-sulfur subunit Locus tag: BB3677 Name: gltA Funciton: Citrate synthase (si) (EC 2.3.3.1)
sdhR-sdhC-sdhD-sdhA-sdhB-COG2938-gltA	-140	7.8	TCTTATATCTTATATAAGACATAAGA	BB3683
Bordetella petrii DSM 12804
Position: -35 Score: 7.81343 Sequence: TCTTATATCTTATATAAGACATAAGA Locus tag: Bpet1819 Name: sdhR Funciton: Transcriptional regulator of TCA cycle, GntR family Locus tag: Bpet1820 Name: sdhC Funciton: Succinate dehydrogenase cytochrome b-556 subunit Locus tag: Bpet1821 Name: sdhD Funciton: Succinate dehydrogenase, hydrophobic subunit, cytochrome b556 Locus tag: Bpet1822 Name: sdhA Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1) Locus tag: Bpet1823 Name: sdhB Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1) Locus tag: Bpet1824 Name: COG2938 Funciton: succinate dehydrogenase iron-sulfur subunit Locus tag: Bpet1825 Name: gltA Funciton: Citrate synthase (si) (EC 2.3.3.1)
sdhR-sdhC-sdhD-sdhA-sdhB-COG2938-gltA	-35	7.8	TCTTATATCTTATATAAGACATAAGA	Bpet1819