Orthologous regulated operons containing pccB gene
| Regulog: | MlnR - Various betaproteobacteria |
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Malonate metabolism |
| Effector: | |
| Phylum: | Proteobacteria/Beta |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Azoarcus sp. EbN1 | ||||
|
Position: -298
Score: 5.85352 Sequence: GCACTCATAATTATGGATAA
Locus tag: ebA3738
Name: mutB Funciton: Methylmalonyl-CoA mutase (EC 5.4.99.2)
Locus tag: ebA3739
Name: ebA3739 Funciton: hypothetical protein
Locus tag: ebA3741
Name: meaB Funciton: auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase
Locus tag: ebA3742
Name: pccB Funciton: Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3)
Locus tag: ebA3743
Name: pccA Funciton: Propionyl-CoA carboxylase, alpha subunit |
||||
| mutB-ebA3739-meaB-pccB-pccA | -298 | 5.9 | GCACTCATAATTATGGATAA | ebA3738 |
| Dechloromonas aromatica RCB | ||||
|
Position: -121
Score: 5.5987 Sequence: GCTTCCATAATTATGGATAC
Locus tag: Daro_4006
Name: mutB Funciton: Methylmalonyl-CoA mutase (EC 5.4.99.2)
Locus tag: Daro_4005
Name: meaB Funciton: auxiliary metallochaperone, involved in the protection and assembly of methylmalonyl-CoA mutase
Locus tag: Daro_4004
Name: pccB Funciton: Propionyl-CoA carboxylase carboxyl transferase subunit (EC 6.4.1.3)
Locus tag: Daro_4003
Name: pccA Funciton: Propionyl-CoA carboxylase, alpha subunit |
||||
| mutB-meaB-pccB-pccA | -121 | 5.6 | GCTTCCATAATTATGGATAC | Daro_4006 |