Orthologous regulated operons containing prpE gene

Properties
Regulog:	MlnR - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Phylum:	Proteobacteria/Beta

Built upon 14 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Dechloromonas aromatica RCB
Position: -49 Score: 5.96971 Sequence: TCATTCGTAATTATGAATAC Locus tag: Daro_1202 Name: ebA7223 Funciton: YhdH, a putative quinone oxidoreductase Locus tag: Daro_1203 Name: Daro_1330 Funciton: Two-component hybrid sensor and regulator Locus tag: Daro_1204 Name: prpE Funciton: Propionate-CoA ligase
ebA7223-Daro_1330-prpE	-49	6	TCATTCGTAATTATGAATAC	Daro_1202
Thauera sp. MZ1T
Position: -64 Score: 4.8576 Sequence: GCGGCTATAATTATGAATCA Locus tag: Tmz1t_1612 Name: ebA7223 Funciton: YhdH, a putative quinone oxidoreductase Locus tag: Tmz1t_1613 Name: Daro_1330 Funciton: Two-component hybrid sensor and regulator Locus tag: Tmz1t_1614 Name: prpE Funciton: Propionate-CoA ligase
ebA7223-Daro_1330-prpE	-64	4.9	GCGGCTATAATTATGAATCA	Tmz1t_1612

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --