Orthologous regulated operons containing HAPS_1138 gene
| Regulog: | TrpR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Haemophilus parasuis SH0165 | ||||
|
Position: -26
Score: 5.74584 Sequence: TGTACTAGTAAAATAGTATT
Locus tag: HAPS_1139
Name: HAPS_1139 Funciton: ABC transporter, inner-membrane component
Locus tag: HAPS_1138
Name: HAPS_1138 Funciton: ABC transporter, ATP-binding protein |
||||
| HAPS_1139-HAPS_1138 | -26 | 5.7 | TGTACTAGTAAAATAGTATT | HAPS_1139 |