Orthologous regulated operons containing HAPS_0395 gene
| Regulog: | TrpR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Haemophilus parasuis SH0165 | ||||
|
Position: -52
Score: 6.58143 Sequence: TGTACTATTTTAATAGTACA
Locus tag: HAPS_0395
Name: HAPS_0395 Funciton: ABC transporter, substrate binding component |
||||
| HAPS_0395 | -52 | 6.6 | TGTACTATTTTAATAGTACA | HAPS_0395 |