Orthologous regulated operons containing aroG gene
| Regulog: | TrpR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | ||||
|
Position: -106
Score: 6.32082 Sequence: TGTACTAGTAAAATAGTTCA
Locus tag: APP7_0666
Name: aroG Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
||||
| aroG | -106 | 6.3 | TGTACTAGTAAAATAGTTCA | APP7_0666 |
| Actinobacillus succinogenes 130Z | ||||
|
Position: -176
Score: 6.65185 Sequence: TGAACTAGTTTACTAGTGCA
Locus tag: Asuc_1428
Name: aroG Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
||||
| aroG | -176 | 6.7 | TGAACTAGTTTACTAGTGCA | Asuc_1428 |
| Haemophilus influenzae Rd KW20 | ||||
|
Position: -81
Score: 6.23662 Sequence: CGAACTAGTTTACTAGTACA
Locus tag: HI1547
Name: aroG Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
||||
| aroG | -81 | 6.2 | CGAACTAGTTTACTAGTACA | HI1547 |
| Haemophilus somnus 2336 | ||||
|
Position: -104
Score: 5.58052 Sequence: GAAATTAGTTTACTAGTACA
Locus tag: HSM_1416
Name: aroG Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
||||
| aroG | -104 | 5.6 | GAAATTAGTTTACTAGTACA | HSM_1416 |
| Mannheimia succiniciproducens MBEL55E | ||||
|
Position: -90
Score: 5.89808 Sequence: TGTACTAGTTTACCAATGCA
Locus tag: MS1184
Name: aroG Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
||||
| aroG | -90 | 5.9 | TGTACTAGTTTACCAATGCA | MS1184 |
| Pasteurella multocida subsp. multocida str. Pm70 | ||||
|
Position: -123
Score: 5.89992 Sequence: AAAACTAGTTTACTAGTGTA
Locus tag: PM0563
Name: aroG Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
||||
| aroG | -123 | 5.9 | AAAACTAGTTTACTAGTGTA | PM0563 |