Orthologous regulated operons containing mtr gene
| Regulog: | TrpR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Actinobacillus succinogenes 130Z | ||||
|
Position: -44
Score: 6.37151 Sequence: TGCACTACTATAATAGTGCA
Locus tag: Asuc_0628
Name: mtr Funciton: Tryptophan-specific transport protein |
||||
| mtr | -44 | 6.4 | TGCACTACTATAATAGTGCA | Asuc_0628 |
| Aggregatibacter aphrophilus NJ8700 | ||||
|
Position: -44
Score: 6.19971 Sequence: TGTACTATTATAATAGTCCA
Locus tag: NT05HA_1570
Name: mtr Funciton: Tryptophan-specific transport protein |
||||
| mtr | -44 | 6.2 | TGTACTATTATAATAGTCCA | NT05HA_1570 |
| Haemophilus influenzae Rd KW20 | ||||
|
Position: -41
Score: 6.46254 Sequence: TGTACTACTATAATAGTGCA
Locus tag: HI0287
Name: mtr Funciton: Tryptophan-specific transport protein |
||||
| mtr | -41 | 6.5 | TGTACTACTATAATAGTGCA | HI0287 |
| Haemophilus somnus 2336 | ||||
|
Position: -49
Score: 6.30536 Sequence: TGAACTATTATAATAGTTCA
Locus tag: HSM_0462
Name: mtr Funciton: Tryptophan-specific transport protein |
||||
| mtr | -49 | 6.3 | TGAACTATTATAATAGTTCA | HSM_0462 |
| Mannheimia succiniciproducens MBEL55E | ||||
|
Position: 1
Score: 6.34514 Sequence: TGTACTACTATAATAGTTCA
Locus tag: MS1895
Name: mtr Funciton: Tryptophan-specific transport protein |
||||
| mtr | 1 | 6.3 | TGTACTACTATAATAGTTCA | MS1895 |
| Pasteurella multocida subsp. multocida str. Pm70 | ||||
|
Position: -61
Score: 6.08274 Sequence: TGCACTATTAAAATAGTGCA
Locus tag: PM1192
Name: mtr Funciton: Tryptophan-specific transport protein |
||||
| mtr | -61 | 6.1 | TGCACTATTAAAATAGTGCA | PM1192 |