Orthologous regulated operons containing trpR gene
| Regulog: | TrpR - Pasteurellales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Actinobacillus succinogenes 130Z | ||||
|
Position: -33
Score: 6.65185 Sequence: TGCACTAGTTTAATAGTGTA
Locus tag: Asuc_1556
Name: trpR Funciton: trp operon repressor |
||||
| trpR | -33 | 6.7 | TGCACTAGTTTAATAGTGTA | Asuc_1556 |
| Aggregatibacter aphrophilus NJ8700 | ||||
|
Position: -31
Score: 6.23662 Sequence: CGCACTAGTTTAATAGTATA
Locus tag: NT05HA_1280
Name: trpR Funciton: trp operon repressor |
||||
| trpR | -31 | 6.2 | CGCACTAGTTTAATAGTATA | NT05HA_1280 |
| Haemophilus influenzae Rd KW20 | ||||
|
Position: -36
Score: 6.65185 Sequence: TGCACTAGTTTAATAGTGTA
Locus tag: HI0830
Name: trpR Funciton: trp operon repressor |
||||
| trpR | -36 | 6.7 | TGCACTAGTTTAATAGTGTA | HI0830 |
| Haemophilus somnus 2336 | ||||
|
Position: -29
Score: 5.50754 Sequence: TACACTAGTTTAATAGTCAG
Locus tag: HSM_1017
Name: trpR Funciton: trp operon repressor |
||||
| trpR | -29 | 5.5 | TACACTAGTTTAATAGTCAG | HSM_1017 |
| Mannheimia succiniciproducens MBEL55E | ||||
|
Position: -42
Score: 6.16087 Sequence: TATACTAGTTTAATAGTATG
Locus tag: MS1566
Name: trpR Funciton: trp operon repressor |
||||
| trpR | -42 | 6.2 | TATACTAGTTTAATAGTATG | MS1566 |