Orthologous regulated operons containing trpB2 gene
| Regulog: | TrpR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -116
Score: 6.08899 Sequence: CGTACTATTTAACTAGTTCA
Locus tag: VPA0585
Name: trpB2 Funciton: Tryptophan synthase beta chain like (EC 4.2.1.20) |
||||
| trpB2 | -116 | 6.1 | CGTACTATTTAACTAGTTCA | VPA0585 |