Orthologous regulated operons containing tnaA gene
| Regulog: | TrpR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio vulnificus CMCP6 | ||||
|
Position: -192
Score: 5.50843 Sequence: CATACTAGTTTATTAGTACA
Locus tag: VV20854
Name: tnaA Funciton: Tryptophanase (EC 4.1.99.1)
Locus tag: VV20855
Name: tnaB Funciton: Tryptophan-specific transport protein |
||||
| tnaA-tnaB | -192 | 5.5 | CATACTAGTTTATTAGTACA | VV20854 |