Orthologous regulated operons containing COG0733 gene
| Regulog: | TrpR - Vibrionales |
| Regulator type: | Transcription factor |
| Regulator family: | TrpR |
| Regulation mode: | repressor |
| Biological process: | Tryptophan biosynthesis |
| Effector: | Tryptophan |
| Phylum: | Proteobacteria/gamma |
| Operon | Position | Score | Sequence | Locus Tag of the First Gene |
|---|---|---|---|---|
| Vibrio cholerae O1 biovar eltor str. N16961 | ||||
|
Position: -41
Score: 6.11045 Sequence: TGTACTAGTTAACTAGTGTG
Locus tag: VC2283
Name: COG0733 Funciton: Predicted tryptophan transporter, SNF family |
||||
| COG0733 | -41 | 6.1 | TGTACTAGTTAACTAGTGTG | VC2283 |
| Vibrio fischeri ES114 | ||||
|
Position: -25
Score: 5.41132 Sequence: TGTACTAGTTGAGTGATACA
Locus tag: VF_0660
Name: COG0733 Funciton: Predicted tryptophan transporter, SNF family |
||||
| COG0733 | -25 | 5.4 | TGTACTAGTTGAGTGATACA | VF_0660 |
| Vibrio harveyi ATCC BAA-1116 | ||||
|
Position: -41
Score: 6.00492 Sequence: TGTACTAGTCAGCTAGTTCA
Locus tag: VIBHAR_03257
Name: COG0733 Funciton: Predicted tryptophan transporter, SNF family |
||||
| COG0733 | -41 | 6 | TGTACTAGTCAGCTAGTTCA | VIBHAR_03257 |
| Vibrio parahaemolyticus RIMD 2210633 | ||||
|
Position: -41
Score: 6.32215 Sequence: TGTACTAGTTAGCTAGTTCA
Locus tag: VP2337
Name: COG0733 Funciton: Predicted tryptophan transporter, SNF family |
||||
| COG0733 | -41 | 6.3 | TGTACTAGTTAGCTAGTTCA | VP2337 |
| Vibrio salmonicida LFI1238 | ||||
|
Position: -23
Score: 4.81139 Sequence: TGTACTAGTGTGGTGATACA
Locus tag: VSAL_I0762
Name: COG0733 Funciton: Predicted tryptophan transporter, SNF family |
||||
| COG0733 | -23 | 4.8 | TGTACTAGTGTGGTGATACA | VSAL_I0762 |
| Vibrio shilonii AK1 | ||||
|
Position: -22
Score: 5.8895 Sequence: TGTACCAGCAAACTAGTACG
Locus tag: VSAK1_12140
Name: COG0733 Funciton: Predicted tryptophan transporter, SNF family |
||||
| COG0733 | -22 | 5.9 | TGTACCAGCAAACTAGTACG | VSAK1_12140 |
| Vibrio splendidus LGP32 | ||||
|
Position: -41
Score: 5.46353 Sequence: TGTACTTCTCAACTAGTTCA
Locus tag: VS_0706
Name: COG0733 Funciton: Predicted tryptophan transporter, SNF family |
||||
| COG0733 | -41 | 5.5 | TGTACTTCTCAACTAGTTCA | VS_0706 |
| Vibrio vulnificus CMCP6 | ||||
|
Position: -38
Score: 6.32215 Sequence: TGTACTAGCTAACTAGTTCA
Locus tag: VV1_1834
Name: COG0733 Funciton: Predicted tryptophan transporter, SNF family |
||||
| COG0733 | -38 | 6.3 | TGTACTAGCTAACTAGTTCA | VV1_1834 |