Orthologous regulated operons containing FTE_0282 gene
Regulog: | TrpR - Francisellaceae |
Regulator type: | Transcription factor |
Regulator family: | TrpR |
Regulation mode: | repressor |
Biological process: | Tryptophan biosynthesis |
Effector: | Tryptophan |
Phylum: | Proteobacteria/Gamma |

Operon | Position | Score | Sequence | Locus Tag of the First Gene |
---|---|---|---|---|
Francisella novicida FTE | ||||
Position: -46
Score: 7.10523 Sequence: TGTAATGGTGTAACATTACA
Locus tag: FTE_0288
Name: trpR Funciton: trp operon repressor
Locus tag: FTE_0287
Name: trpE Funciton: Anthranilate synthase, aminase component (EC 4.1.3.27)
Locus tag: FTE_0286
Name: trpD_a Funciton: Anthranilate synthase, amidotransferase component (EC 4.1.3.27)
Locus tag: FTE_0285
Name: trpD_b Funciton: Anthranilate phosphoribosyltransferase (EC 2.4.2.18)
Locus tag: FTE_0284
Name: null Funciton: hypothetical protein
Locus tag: FTE_0283
Name: FTE_0283 Funciton: hypothetical protein
Locus tag: FTE_0282
Name: null Funciton: hypothetical protein
Locus tag: FTE_0281
Name: msrA Funciton: Peptide methionine sulfoxide reductase (EC 1.8.4.11)
Locus tag: FTE_0280
Name: FTE_0280 Funciton: hypothetical protein
Locus tag: FTE_0278
Name: trpC Funciton: Indole-3-glycerol phosphate synthase (EC 4.1.1.48) / Phosphoribosylanthranilate isomerase (EC 5.3.1.24) |
||||
trpR-trpE-trpD_a-trpD_b-FTE_0284-FTE_0283-FTE_0282-msrA-FTE_0280-trpC | -46 | 7.1 | TGTAATGGTGTAACATTACA | FTE_0288 |