Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Pjdr2_1898 gene

Properties
Regulog: YhcF2 - Bacillales
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug resistance; Multidrug efflux
Effector:
Phylum: Firmicutes
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Paenibacillus sp. JDR-2
Position: -35
Score: 6.01543
Sequence: TTGTATTAGTCGATTAATACAG
Locus tag: Pjdr2_1896
Name: null
Funciton: hypothetical protein
Locus tag: Pjdr2_1897
Name: null
Funciton: hypothetical protein
Locus tag: Pjdr2_1898
Name: null
Funciton: hypothetical protein
Locus tag: Pjdr2_1899
Name: null
Funciton: ABC transporter related
Pjdr2_1896-Pjdr2_1897-Pjdr2_1898-Pjdr2_1899 -35 6 TTGTATTAGTCGATTAATACAG Pjdr2_1896