Orthologous regulated operons containing Pjdr2_1897 gene

Properties
Regulog:	YhcF2 - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug resistance; Multidrug efflux
Effector:
Phylum:	Firmicutes

Built upon 9 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Paenibacillus sp. JDR-2
Position: -35 Score: 6.01543 Sequence: TTGTATTAGTCGATTAATACAG Locus tag: Pjdr2_1896 Name: null Funciton: hypothetical protein Locus tag: Pjdr2_1897 Name: null Funciton: hypothetical protein Locus tag: Pjdr2_1898 Name: null Funciton: hypothetical protein Locus tag: Pjdr2_1899 Name: null Funciton: ABC transporter related
Pjdr2_1896-Pjdr2_1897-Pjdr2_1898-Pjdr2_1899	-35	6	TTGTATTAGTCGATTAATACAG	Pjdr2_1896

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --